Πέμπτη, 10 Ιουλίου 2014

Καφέ αρκούδα στο Εθνικό Πάρκο Β. Πίνδου


Το παρόν βίντεο, αφορά υλικό το οποίο παρέδωσε Γερμανός επισκέπτης, στο
Φορέα Διαχείρισης Εθνικού Πάρκου Β. Πίνδου και τον οποίο θερμά
ευχαριστούμε. Για λόγους εμπιστευτικότητας, διατηρούμε ανώνυμη την
ακριβή τοποθεσία λήψης του ζώου.

Το Εθνικό Πάρκο Βόρειας Πίνδου
βρίσκεται στη βορειοδυτική Ελλάδα στα όρια των Νομών Ιωαννίνων και
Γρεβενών. Έχει έκταση 2000 τετρ. χιλμ. και είναι από τα σημαντικότερα
εθνικά πάρκα στη χώρα μας. Περιλαμβάνει τους δύο Εθνικούς Δρυμούς: του
Βίκου-Αώου και της Πίνδου (Βάλια-Κάλντα), καθώς και τη μεταξύ τους
γεωγραφική θέση.

Συνολικά, στο Εθνικό Πάρκο της Βόρειας Πίνδου
περιλαμβάνονται έντεκα περιοχές του δικτύου NATURA 2000, στις οποίες
προστατεύονται σημαντικά είδη χλωρίδας και πανίδας. Ένα από τα σπάνια
ζώα που θα συναντήσουμε είναι και η καφέ αρκούδα (Ursus arctos).

Πέμπτη, 12 Ιουνίου 2014

Σε επιφυλακή για τις ακτές αλλά και τα δάση!!!!

Από το Παγκόσμιο Ταμείο για τη Φύση (WWF) Ελλάδος:
 Αγαπητοί Φίλοι,
Μια από τις πρωτοβουλίες πολιτών για την προστασία των ακτών διοργανώνει μεθαύριο Πέμπτη 12/6 συγκέντρωση διαμαρτυρίας ενάντια στο νομοσχέδιο του αιγιαλού στο Σύνταγμα, στην Αθήνα, στις 18:00 (Ραντεβού στο κεντρικό σιντριβάνι της πλατείας.) Θα βρεθούμε εκεί και σας περιμένουμε μαζί μας!
Στο μεταξύ, σας γράφω τις τελευταίες εξελίξεις για τις ακτές αλλά και για άλλη μια ‘κεραμίδα’ που έρχεται: το νέο δασικό νομοσχέδιο. Δυστυχώς το τελευταίο έχει πάρει λιγότερη δημοσιότητα, και ελπίζουμε αυτό να αλλάξει ώστε να προλάβουμε δυσάρεστες εξελίξεις.
http://www.wwf.gr/newsletter/aigialos4/call.jpg
Μετά την παράδοση 112 χιλιάδων υπογραφών διαμαρτυρίας στο Υπουργείο Οικονομικών (σήμερα έχουν ξεπεράσει τις 140 χιλιάδες!), η κυβέρνηση άφησε να εννοηθεί ότι ‘θα λάβει υπόψη τις αντιδράσεις’. Χαρήκαμε για τη μαζική κινητοποίηση που ήρθε από πολλούς ανεξάρτητους φορείς αλλά και δίκτυα πολιτών (όπως η πρωτοβουλία STOP) και είμαστε περήφανοι που η δουλειά της νομικής μας ομάδας παρείχε τεκμηριωμένη βάση στο κύμα αντίδρασης. Λίγες μέρες μετά, καταθέσαμε και μια θετική νομική πρόταση
Παρόλα αυτά είμαστε ανήσυχοι για τη συνέχεια. Ο φόβος μας είναι ότι το νομοσχέδιο θα κατέβει για ψήφιση στη βουλή, ή με ‘αόρατο μανδύα’ (δηλαδή με τις διατάξεις του διασπαρμένες σε άλλα άσχετα νομοσχέδια) ή με τη διαδικασία του ‘κατεπείγοντος’. Γι’αυτό παραμένουμε σε επιφυλακή.
Στο μεταξύ, τα διεθνή ΜΜΕ προέβαλαν το θέμα. Η βρετανική Guardian, αναφέρει ότι το νομοσχέδιο απειλεί ‘μια από τις πιο παρθένες ακτογραμμές ολόκληρης της ευρωπαϊκής ηπείρου’, προωθώντας τη χαοτική ανάπτυξη των ακτών της Ιταλίας και της Ισπανίας. Ο διευθυντής του WWF Ισπανίας, απήυθυνε έκκληση στους Έλληνες Υπουργούς: «μην καταστρέψετε τις ακτές σας όπως εμείς». Η Ισπανία ακολούθησε το μοντέλο του ‘χτίστε ελεύθερα παντού’ και πλήρωσε το τίμημα. Σήμερα, το 75% των ακτών της έχει οικοδομηθεί, ο τουρισμός της έχει σε μεγάλο βαθμό υποβαθμιστεί, ενώ ταυτόχρονα περίπου μισό εκατομμύριο παραθεριστικές κατοικίες είναι κενές.
Και το άλλο κομμάτι του παζλ που έρχεται να συμπληρώσει την εικόνα: το νέο δασικό νομοσχέδιο. Δεν έχουμε ακόμα δει την τελική του μορφή, όμως τον περασμένο Σεπτέμβρη όταν είχε τεθεί σε δημόσια διαβούλευση, οι προθέσεις του ήταν σαφείς: οικολογικά πολύτιμες εκτάσεις μένουν εκτός ουσιαστικής προστασίας. Κάθε λογής παρέμβαση διευκολύνεται στα δάση και τις δασικές εκτάσεις, ακόμα και για τουριστικές επενδύσεις. Νομιμοποιούνται αυθαίρετα ακόμα και σε προστατευόμενες περιοχές! Ενώ ορισμένες εκτάσεις που καίγονται δε θα κηρύσσονται πια αναδασωτέες…
Τα νομοσχέδια αυτά φανερώνουν μια ξεκάθαρη λογική: η λύση που προωθείται για το αναπτυξιακό πρόβλημα της Ελλάδας είναι η διάλυση της περιβαλλοντικής προστασίας.  
Όπου γης, οικοδομή; Όχι! Μας πειράζει ότι γι’αυτές τις επενδύσεις το φυσικό περιβάλλον έχει ημερομηνία λήξης. Ότι αδικούνται όλοι οι άλλοι επενδυτές που έχουν σεβαστεί τους νόμους και το δημόσιο συμφέρον. Ότι έτσι θα υποβαθμιστεί η μοναδική φυσική ομορφιά της χώρας μας, ο ίδιος δηλαδή ο λόγος που οι τουρίστες επισκέπτονται τη χώρα μας.
Το υλικό της εκστρατείας μας είναι συγκεντρωμένο εδώ. Θα σας κρατήσουμε ενήμερους για τις εξελίξεις!

Τετάρτη, 4 Ιουνίου 2014

Θέματα και απαντήσεις Βιολογίας Θετ. Κατ. 2014

Παραθέτω τα θέματα Βιολογίας Κατεύθυνσης, τα οποία ταλαιπώρησαν κόσμο σήμερα, καθώς κάποια φροντιστήρια που βιάστηκαν να αναρτήσουν τις λύσεις, έκαναν λάθος στην απάντηση του ερωτήματος Δ4(!). Η Πανελλήνια Ένωση Βιοεπιστημόνων χαρακτήρισε τα θέματα απαιτητικά, σχετικά μεγάλης έκτασης, με σαφή διαβάθμιση δυσκολίας, ενώ καλύπτουν ένα ικανό μέρος της διδακτέας ύλης.

Αρκετά θέματα απαιτούσαν κριτική προσέγγιση και αναλυτική σκέψη. Οι μαθητές/τριες με βαθιά κατανόηση και γνώση της εξεταζόμενης ύλης μπορούν να ανταποκριθούν με επάρκεια στις απαιτήσεις της εξέτασης. Επισημαίνεται ότι οι αιτιολογήσεις που ζητούνται σε κάποια θέματα επιδέχονται εναλλακτικές απαντήσεις, τις οποίες πρέπει να λάβουμε υπόψη μας οι βαθμολογητές. Απαιτείται, όμως, επιπλέον διευκρίνιση για το ερώτημα Δ4. 
Πατήστε εδώ για να δείτε τα θέματα. Οι απαντήσεις που προτείνει η ΠΕΒ είναι:

ΠΡΟΤΕΙΝΟΜΕΝΕΣ ΑΠΑΝΤΗΣΕΙΣ ΣΤΑ ΘΕΜΑΤΑ ΤΗΣ ΒΙΟΛΟΓΙΑΣ ΘΕΤΙΚΗΣ ΚΑΤΕΥΘΥΝΣΗΣ ΗΜΕΡΗΣΙΩΝ ΓΕΝΙΚΩΝ ΛΥΚΕΙΩΝ 
Τετάρτη, 4 Ιουνίου 2014

ΘΕΜΑ Α 

1. δ
2. γ
3. β
4. γ
5. β

ΘΕΜΑ Β

Β1.
Η σειρά των βημάτων που οδηγούν στην κατασκευή καρυότυπου είναι: 4,2,1,6,3,5.

Β2.
α. DNA πολυμεράσες
β. πριμόσωμα
γ. DNA δεσμάση
δ. DNA ελικάσες
ε. RNA πολυμεράση/ες

Β3.
Η διάγνωση των γενετικών ασθενειών μπορεί να πραγματοποιηθεί :
        Με τη μελέτη του καρυοτύπου, όπως για παράδειγμα κατά τον προγεννητικό έλεγχο.
        Με διάφορες βιοχημικές δοκιμασίες.
        Με την ανάλυση της αλληλουχίας των βάσεων του DNA (μοριακή διάγνωση).
Σημείωση 1: Μια άλλη αναφερόμενη μέθοδος διάγνωσης γενετικών ασθενειών (δρεπανοκυτταρική αναιμία) είναι η παρατήρηση της μορφολογίας των ερυθρών αιμοσφαιρίων (δοκιμασία δρεπάνωσης). Η αναφορά του συγκεκριμένου είναι εντός θέματος.
Σημείωση 2: Η αναφορά σε μονοκλωνικά αντισώματα (ανοσοδιαγνωστικά) δεν είναι λανθασμένη.

Β4.
Διαγονιδιακά ονομάζονται τα ζώα εκείνα στα οποία έχει τροποποιηθεί το γενετικό υλικό τους με την προσθήκη γονιδίων, συνήθως από κάποιο άλλο είδος.
Σχόλιο: Η παράθεση του ορισμού των διαγονιδιακών φυτών και ζώων, σελ. 131 του σχολικού βιβλίου, είναι δεκτή αλλά όχι η πληρέστερη.

Β5.
Με τον όρο ζύμωση εννοούμε τη διαδικασία ανάπτυξης μικροοργανισμών σε υγρό θρεπτικό υλικό κάτω από οποιεσδήποτε συνθήκες.
Τα προϊόντα της ζύμωσης είναι είτε τα ίδια τα κύτταρα που ονομάζονται βιομάζα είτε προϊόντα των κυττάρων όπως πρωτεΐνες και αντιβιοτικά.

ΘΕΜΑ Γ

Γ1.
Αν το υπεύθυνο αλληλόμορφο είναι επικρατές, τότε το άτομο ΙΙ3 είναι ομόζυγο ή ετερόζυγο για το επικρατές. Όμως πρέπει να το έχει κληρονομήσει από ένα τουλάχιστον γονέα ο οποίος και θα το εμφάνιζε, γεγονός που δεν ισχύει.
Αν το υπεύθυνο αλληλόμορφο είναι υπολειπόμενο εκφράζεται στον ΙΙ3 ενώ στους γονείς καλύπτεται από το επικρατές φυσιολογικό αλληλόμορφο η έκφραση του. Άρα το υπεύθυνο γονίδιο είναι υπολειπόμενο.

Γ2.
Το υπεύθυνο γονίδιο είναι υπολειπόμενο και:
α) Εάν είναι φυλοσύνδετο, τότε η ασθενής ΙΙΙ1 έχει γονότυπο ΧαΧα και πρέπει να έχει κληρονομήσει από τον πατέρα ΙΙ4 το Χα . Τότε ο ΙΙ4 θα ήταν ασθενής, γεγονός που δεν ισχύει άρα άτοπο.
β) Εάν είναι αυτοσωμικό τότε ο ασθενής ΙΙ3 είναι ομόζυγος (αα) και οι δύο γονείς είναι ετερόζυγοι (Αα) με φυσιολογικό φαινότυπο.
Τελικά το υπεύθυνο γονίδιο είναι υπολειπόμενο αυτοσωμικό.

ή
Με διασταυρώσεις. Ενδεικτικά:
   (Α)


Ι1
Ι2
P1:
Αα       (χ)
Αα
Γαμέτες:
Α   ,  α
Α  ,  α
F1:
AA, Αα, Αα,
αα
Φαινότυποι:
Φυσιολογικά
( ΙΙ1 , ΙΙ2 , ΙΙ4 )
Ασθενείς
( ΙΙ3 )
  
 και
   (Β)


ΙΙ4
ΙΙ5
P2:
Αα      (χ)
αα
Γαμέτες:
Α  ,  α
α
F2:
Aα       , 
αα
Φαινότυποι:
φυσιολογικά
( - )
Ασθενείς
(ΙΙΙ1)

Σχόλιο: Η διερεύνηση και αντίστοιχα η βαθμολόγηση των ερωτημάτων Γ1 και Γ2 μπορεί να γίνει με ενιαίο τρόπο.

Γ3. Πιθανοί γονότυποι:
ΙΙ1
ΑΑ   ή
Αα
ΙΙ2
ΑΑ   ή
Αα
ΙΙ3
αα

ΙΙ4
Αα



Γ4.
Ο ανιχνευτής για το μεταλλαγμένο αλληλόμορφο δεν υβριδοποιείται με το γενετικό υλικό του ΙΙ1, άρα αυτό δεν έχει το υπολειπόμενο αλληλόμορφο και ο γονότυπός του είναι: ΑΑ.
Στο γενετικό υλικό του ΙΙ2 ο ανιχνευτής υβριδοποιεί μόνο ένα μόριο DNA, άρα ο ΙΙ2 περιέχει ένα αλληλόμορφο υπολειπόμενο, είναι ετερόζυγος με γονότυπο: Αα.
Κάθε άτομο έχει στο γονιδίωμα του δύο αλληλόμορφα για το γνώρισμα αυτό, ένα πατρικής και ένα μητρικής προέλευσης.
Στα ετερόζυγα άτομα το επικρατές καλύπτει την έκφραση του υπολειπόμενου και έχουν φυσιολογικό φαινότυπο. Ο ανιχνευτής είναι μια αλληλουχία DNA ή RNA συμπληρωματική με την αλληλουχία του ζητούμενου γονιδίου, το οποίο υβριδοποιείται με μία αλυσίδα DNA του γονιδίου, που έχει πριν αποδιαταχθεί.
Σχόλιο: Η αναφορά της διαδικασίας υβριδοποίησης, σελ. 60 του σχολικού βιβλίου, είναι εντός θέματος αλλά δεν αποτελεί ζητούμενο.



Γ5.
Η μερική αχρωματοψία στο πράσινο και το κόκκινο ακολουθεί φυλοσύνδετο υπολειπόμενο τύπο κληρονομικότητας.
Ορίζουμε ΧΑ ως φυσιολογικό γονίδιο και Χα ως το υπολειπόμενο γονίδιο της αχρωματοψίας.
Έτσι, ο πατέρας  θα έχει γονότυπο ΧΑΥ (φυσιολογικός), ενώ η μητέρα ΧΑΧΑ ή ΧΑΧα. ( φυσιολογική) Το παιδί το οποίο πάσχει από σύνδρομο Klinefelter και μερική αχρωματοψία έχει γονότυπο ΧαΧαΥ.
Το παιδί δεν μπορεί να κληρονόμησε Χα από τον πατέρα του, αφού αυτός διαθέτει το επικρατές αλληλόμορφο γονίδιο. Άρα κληρονόμησε το Υ από τον πατέρα και ΧαΧα από τη μητέρα. Επομένως συνέβη λάθος κατά το σχηματισμό των γαμετών στη μητέρα, το οποίο οδήγησε στη δημιουργία ωαρίου με ΧαΧα .
Το λάθος συνέβη στη δεύτερη μειωτική διαίρεση (μη-διαχωρισμός αδελφών χρωματίδων του Χα χρωμοσώματος ) και τελικώς προκύπτουν γαμέτες που φέρουν ζεύγος πανομοιότυπων χρωμοσωμάτων (ΧαΧα ).
Άρα, προέκυψε ωάριο που έφερε το φυσιολογικό αριθμό αυτοσωμικών χρωμοσωμάτων (22) και δύο φυλετικά χρωμοσώματα ΧαΧα. Γονιμοποίηση αυτού του ωαρίου από φυσιολογικό σπερματοζωάριο που έφερε το Υ χρωμόσωμα οδήγησε στη δημιουργία ζυγωτού με γονότυπο ΧαΧαΥ.

ΘΕΜΑ Δ

Δ1.
Η αλυσίδα Ι αποτελεί την κωδική αλυσίδα. Σε αυτήν εντοπίζεται το κωδικόνιο έναρξης των 5΄–ATG–3΄ και με βήμα τριπλέτας υπάρχουν τα υπόλοιπα επτά κωδικόνια αμινοξέων. Οπότε, τα άκρα της αλυσίδας Ι είναι: 5΄- AGCTATGACCATGATTACGGATTCACTG -3΄ .     
Και η αλυσίδα ΙΙ που είναι αντιπαράλληλη της αλυσίδας Ι θα έχει τα εξής άκρα: 3΄- TCGATACTGGTACTAATGCCTAAGTGAC -5΄.
Το κωδικόνιο έναρξης της πρωτεϊνοσύνθεσης του mRNA, 5΄-AUG-3΄ είναι συμπληρωματικό και αντιπαράλληλο με το 3΄-TAC-5΄ της μη κωδικής αλυσίδας ΙΙ του γονιδίου, άρα ο προσανατολισμός του κωδικονίου έναρξης της πρωτεϊνοσύνθεσης ATG, της κωδικής αλυσίδας του γονιδίου είναι 5΄-ATG –3΄.

Δ2.
Η μεταγραφή γίνεται με κατεύθυνση 5΄à 3΄και το mRNA που προκύπτει είναι συμπληρωματικό και αντιπαράλληλο της μη κωδικής αλυσίδας.
Το mRNA είναι 5΄- AGCUAUGACCAUGAUUACGGAUUCACUG -3΄.

Δ3.
Κατά την έναρξη της μετάφρασης το mRNA προσδένεται, μέσω μιας αλληλουχίας που υπάρχει στην 5΄ αμετάφραση περιοχή του, με το ριβοσωμικό RNA της μι­κρής υπομονάδας του ριβοσώματος, σύμφωνα με τους κανόνες της συμπληρωματικότητας των βάσεων.
Συνεπώς η μικρή υπομονάδα του ριβοσώματος προσδένεται με το τμήμα 5΄… AGCU-3΄.  

Δ4.
Μπορεί να έγινε αντικατάσταση μιας βάσης στο κωδικόνιο έναρξης 5΄–ATG–3΄ με αποτέλεσμα αυτό να μετατραπεί σε μία τριπλέτα που δεν σηματοδοτεί την έναρξη. Ως κωδικόνιο έναρξης της πρωτεΪνοσύνθεσης θα μπορούσε πλέον να λειτουργήσει η μεθεπόμενη τριπλέτα βάσεων ATG (AUG στο mRNA), με αποτέλεσμα το mRNA που θα παραχθεί να έχει δύο λιγότερα κωδικόνια, άρα και το πρωτεϊνικό προϊόν δύο λιγότερα αμινοξέα.
Σημείωση: Στην εκφώνηση του υποερωτήματος: «…στο παραπάνω τμήμα DNA…». Η διατύπωση αυτή μπορεί να θεωρηθεί ότι αναφέρεται σε ολόκληρο το δομικό γονίδιο του οπερονίου της λακτόζης. Σε μια τέτοια προσέγγιση είναι δεκτή και μια εναλλακτική απάντηση. Ειδικότερα, ότι η μετάλλαξη οδήγησε στην δημιουργία κωδικονίου λήξης, δύο κωδικόνια πριν από το αρχικό κωδικόνιο λήξης αυτού του γονιδίου, με αποτέλεσμα πάλι το πρωτεϊνικό προϊόν να έχει δύο λιγότερα αμινοξέα. Αυτό, φυσικά, αποτελεί υπόθεση σύμφωνη με μια τέτοιου τύπου ανάγνωση της εκφώνησης.
 
Δ5.
Το ρυθμιστικό γονίδιο είναι υπεύθυνο για την έκφραση της πρωτεΐνης καταστολέα του οπερονίου της λακτόζης. Προσθήκη τεσσάρων βάσεων μεταξύ του 3ου και 4ου κωδικονίου, στο ρυθμιστικό γονίδιο, μπορεί να αλλάξει όλη την αλληλουχία των κωδικονίων από το 4ο κωδικόνιο και μετά με αποτέλεσμα την αλλαγή της παραγόμενης πρωτεΐνης.
Συνεπώς, το τροποποιημένο πρωτεϊνικό προϊόν πιθανός να μη λειτουργεί ως καταστολέας.
Ο τροποποιημένος καταστολέας απουσία της λακτόζης πιθανότατα δεν προσδένεται στον χειριστή, όπως θα έκανε φυσιολογικά. Η RNA πολυμεράση καταλύει τη μεταγραφή των τριών δομικών γονιδίων και τελικά την παραγωγή των ένζυμων, των απαραίτητων για την διάσπαση της λακτόζης.  
Σχόλιο: Στα πλαίσια του σχολικού βιβλίου, βέβαια, στο θρεπτικό υλικό των ετερότροφων βακτηρίων, υποχρεωτικά πρέπει να περιλαμβάνεται μια πηγή C (άνθρακα

Παρασκευή, 30 Μαΐου 2014

Θέματα και απαντήσεις Βιολογίας Γενικής Παιδείας 2014

Σήμερα πραγματοποιήθηκε η εξέταση της Βιολογίας Γενικής Παιδείας. Τα θέματα χαρακτηρίστηκαν από την Πανελλήνια Ένωση Βιοεπιστημόνων βατά και διαβαθμισμένης δυσκολίας.Εύχομαι καλά αποτελέσματα και καλή συνέχεια σε όλους. Για τα θέματα πατήστε εδώ.

Και οι απαντήσεις είναι:


ΘΕΜΑ Α 
1. δ 
2. β
3. γ 
4. β 
5. α

ΘΕΜΑ Β
Β1.
Η απάντηση βρίσκεται στη σελίδα 10 του σχολικού βιβλίου: «Τέτοιες διαταραχές μπορεί να οφείλονται σε παθογόνους μικροοργανι­σμούς, σε ακραίες μεταβολές των περιβαλ­λοντικών συνθηκών (θερμοκρασία, ακτινο­βολίες, διαθεσιμότητα οξυγόνου), ενώ συ­χνά είναι απόρροια του τρόπου ζωής (κά­πνισμα, αλκοόλ κτλ.)».
Σχόλιο: Αποδεχτή γίνεται και η παράθεση άλλων παραγόντων (παραδειγμάτων) που είναι επιστημονικά δόκιμοι.
 
Β2.
Η απάντηση βρίσκεται στη σελίδα 25 του σχολικού βιβλίου, ενδεικτικά:
- Θέρμανση στους 62 0C για μισή ώρα.
- Καταστρέφονται όλα τα παθογόνα και τα περισσότερα μη παθογόνα, ενώ διατηρείται η γεύση του.

Β3.
Η απάντηση βρίσκεται στη σελίδα 48 του σχολικού βιβλίου:
είτε, με την ανίχνευση του RNA του ιού.
Είτε, με την ανίχνευση των ειδικών για τον ιό αντισωμάτων στο αίμα του ασθενούς.

Β4.
Η απάντηση βρίσκεται στη σελίδα 129 του σχολικού βιβλίου: «Οι συνθήκες του πε­ριβάλλοντος διαφέρουν από περιοχή σε περιοχή και από χρονική στιγμή σε χρονική στιγμή. Έτσι είναι δυνατόν ένα χαρακτηρι­στικό που αποδεικνύεται προσαρμοστικό σε μια περιοχή μια καθορισμένη χρονική στιγμή να είναι άχρηστο ή και δυσμενές σε μια άλλη περιοχή ή σε μια άλλη χρονική στιγμή».
Σχόλιο: Στοιχεία της απάντησης υπάρχουν και στην τελευταία παράγραφο της σελίδας 126 του σχολικού βιβλίου, αλλά δεν απαιτείται η παράθεση τους.

ΘΕΜΑ Γ

Γ1.
Καμπύλη Α: αντιγόνα
Καμπύλη Β: αντισώματα

Γ2.
Η ανοσοβιολογική απόκριση είναι πρωτογενής.
Καμπύλη Α:
Μόλυνση. Αμέσως μετά η συγκέντρωση των ιών αυξάνεται, καθώς ο ιός εγκαθίσταται και πολλαπλασιάζεται μέσα σε κύτταρα του ανθρώπου – ξενιστή. Στη συνέχεια η συγκέντρωση των ιών μειώνεται, καθώς οι ιοί αντιμετωπίζονται από τους αμυντικούς μηχανισμούς. Κυρίως εξουδετερώνονται από τα αντισώματα που έχουν ήδη αρχίσει να παράγονται. Όσο αυξάνεται η συγκέντρωση των αντισωμάτων, μειώνεται η συγκέντρωση των ιών. Επίσης, οι ιοί μειώνονται και λόγω της δράσης των κυτταροτοξικών Τ-λεμφοκυττάρων. Τελικά, η συγκέντρωση των ιών μηδενίζεται, λόγω της δράσης των αντισωμάτων και των κυτταροτοξικών Τ-λεμφοκυττάρων.
Καμπύλη Β:
Η συγκέντρωση των αντισωμάτων αρχίζει να αυξάνεται μετά από αρκετό χρονικό διάστημα από την μόλυνση, ένδειξη ότι είναι η πρώτη επαφή του ανθρώπου με τον ιό αυτό και επομένως εκδηλώνει πρωτογενή ανοσοβιολογική απόκριση. Το χρονικό αυτό διάστημα απαιτείται για την ενεργοποίηση της ανοσοβιολογικής απόκρισης, με αποτέλεσμα την παραγωγή και έκκριση μεγάλης ποσότητας αντισωμάτων (από τα πλασματοκύτταρα), αυξάνοντας την συγκέντρωσή των αντισωμάτων όπως φαίνεται στη καμπύλη Β.
Όταν μηδενίζεται η συγκέντρωση των ιών, τερματίζεται η ανοσοβιολογική απόκριση, μειώνεται η συγκέντρωση των αντισωμάτων, ενώ αντισώματα παραμένουν στον οργανισμό σε χαμηλή συγκέντρωση.
Σχόλιο 1: Η έλλειψη αριθμητικών ενδείξεων βαθμονόμησης του άξονα του χρόνου, αποτελεί σημαντική παράληψη για την σαφήνεια του θέματος.
Σχόλιο 2: Ζητώντας περιγραφή των καμπύλων θεωρούμε ότι η ερώτηση αναφέρεται στις μεταβολές των συγκεντρώσεων.

Γ3.
Ενεργοποιούνται τα βοηθητικά Τ-λεμφοκύτταρα, τα κυτταροτοξικά Τ-λεμφοκύτταρα και τα κατασταλτικά Τ-λεμφοκύτταρα. Παράγονται επιπλέον βοηθητικά Τ-λεμφοκύτταρα μνήμης και κυτταροτοξικά Τ-λεμφοκύτταρα μνήμης. 
Σχόλιο: Η διατύπωση της ερώτησης «…που παράγονται...» μπορεί να οδηγήσει σε άλλη απάντηση από τη ζητούμενη. Αυτό θα πρέπει να ληφθεί υπόψη κατά τη βαθμολόγηση των γραπτών.    

Γ4.
Η απάντηση βρίσκεται στη σελίδα 34 του σχολικού βιβλίου: Παραγωγή ιντερφερονών (ουσίες με αντιμικροβιακή δράση).
«Στην περίπτωση των ιών δρα ένας επιπλέον μηχανισμός μη ειδικής άμυνας. Όταν κάποιος ιός μολύνει ένα κύτταρο, προκαλεί την παραγωγή ειδικών πρωτεϊνών, των ιντερφερονών. Σε ένα πρώτο στάδιο οι ιντερφερόνες ανιχνεύονται στο κυτταρόπλασμα του μο-λυσμένου κυττάρου. Σε επόμενο όμως στάδιο οι ιντερφερόνες απελευθερώνονται στο μεσοκυττάριο υγρό και από εκεί συνδέονται με υποδοχείς των γειτονικών υγιών κυττάρων. Με τη σύνδεση των ιντερφερονών στα υγιή κύτταρα ενεργοποιείται η παραγωγή άλλων πρωτεϊνών, οι οποίες έχουν την ικανότητα να παρεμποδίζουν τον πολλαπλασιασμό των ιών. Έτσι τα υγιή κύτταρα προστατεύονται, γιατί ο ιός, ακόμη και αν κατορθώσει να διεισδύσει σ’ αυτά, είναι ανίκανος να πολλαπλασιαστεί».

ΘΕΜΑ Δ
Δ1.

Έχει υπολογιστεί ότι μόνο το 10% περίπου της ενέργειας ενός τροφικού επιπέδου περνάει στο επόμενο, καθώς το 90% της ενέργειας χάνεται. Αυτό οφείλεται στο ότι:
- Ένα μέρος της χημικής ενέργειας με­τατρέπεται με την κυτταρική αναπνοή σε μη αξιοποιήσιμες μορφές ενέρ­γειας (π.χ. θερμότητα).
- Δεν τρώγονται όλοι οι οργανισμοί.
- Ορισμένοι οργανισμοί πεθαίνουν.
- Ένα μέρος της οργανικής ύλης απο­βάλλεται με τα κόπρανα και τα ούρα (α­πεκκρίσεις), τα οποία αποικοδομούνται.
Σχόλιο: Ζητείται η ενέργεια σε κάθε τροφικό επίπεδο.

Δ2.
Οι βάτραχοι αποτελούν τον μοναδικό καταναλωτή των ακρίδων, επομένως η μείωση του αριθμού των βατράχων θα οδηγήσει σε αύξηση του αριθμού των ακρίδων.
Στη συνέχεια ως αποτέλεσμα της αύξησης του πληθυσμού των ακρίδων, θα μειωθεί ο πληθυσμός των ποωδών φυτών, τα οποία καταναλώνονται από τις ακρίδες. 

Δ3.
Οι ουσίες αυτές  δε διασπώνται (μη βιοδιασπώμενες ουσίες) και δε μεταβολίζονται από τους οργανισμούς, με αποτέλεσμα, να συσσωρευτούν  στους ιστούς και φυσικά δε θα αποβληθούν με τις απεκκρίσεις. Συνεπώς, θεωρείται ότι η ποσότητα στους κορυφαίους καταναλωτές (γεράκια) είναι 1mg.
Σχόλιο 1: Επισημαίνεται ότι το ερώτημα αναφέρεται, στο σύνολο των ποωδών φυτών και στο σύνολο των γερακιών, δηλαδή στα αντίστοιχά τους τροφικά επίπεδα.
Σχόλιο 2: Στα πλαίσια του σχολικού βιβλίου παραβλέπεται η διασπορά της μη βιοδιασπώμενης ουσίας. Επισημαίνεται όμως, η προφανής αντίφαση με ζητούμενα του θέματος Δ1.

Δ4.
( i )  1. CO2
       7. νιτρικά ιόντα
( ii ) 2. φωτοσύνθεση (πρόσληψη CO2 )
       3. κυτταρική αναπνοή (αποβολή CO2 )
       4. διαπνοή ή επιδερμική εξάτμιση (εξάτμιση)  
       8. βιολογική αζωτοδέσμευση
       9. ατμοσφαιρική αζωτοδέσμευση
     10. απονιτροποίηση (ή μετατροπή νιτρικών ιόντων σε μοριακό άζωτο)
( iii ) 5. αποικοδομητές (ορισμένα βακτήρια και μύκητες)
         6. νιτροποιητικά βακτήρια